quarta-feira, 23 de dezembro de 2009

Feliz Natal


Feliz Natal - Merry Christmas
Feliz Navidad - Joyeux Noël - Buon Natale
Frohe Weihnachten

terça-feira, 8 de dezembro de 2009

Recomendações de Saúde

Vivemos numa época em que o computador é indispensável na realização das tarefas profissionais e, para muitos, para entretenimento.

Horas e horas em frente ao computador trás riscos à saúde, e a visão é a primeira a ser afectada.

Numa pesquisa pela Internet, encontrei alguns conselhos úteis que deixo a todos os leitores deste espaço:


Fonte:
http://nata.pt/ftp/nata/transitions_eye_care_pt.pdf

sexta-feira, 20 de novembro de 2009

Universo (NG7 - DR4)




Máquina do Mundo
O Universo é feito essencialmente de coisa nenhuma.
Intervalos, distâncias, buracos, porosidade etérea.
Espaço vazio, em suma.
O resto é matéria.
Daí, que este arrepio,
este chamá-lo e tê-lo,
erguê-lo e defrontá-lo,
esta fresta de nada aberta no vazio,
deve ser um intervalo.
António Gedeão



Fonte: http://cienciastic.fc.ul.pt/universo/
.



---------------------------------------------------------------------------------------
Mobilizar o saber formal na interpretação de leis e modelos científicos num contexto de coexistência de estabilidade e mudança.
---------------------------------------------------------------------------------------
Sociedade: Actuar perante fenómenos sociais complexos, concebendo-os como resultado de evoluções históricas e adoptando configurações diversas consoante as sociedades e/ou os grupos sociais.
Tecnologia: Actuar de forma a compreender que as soluções técnicas têm validade limitada e que têm tendência a mudar, tal como muda a ciência e a própria sociedade.
Ciência: Actuar tendo em conta que se vive num mundo onde coexistem leis científicas de invariância (que valorizam a estabilidade) e leis científicas de evolução (que apontam para a mudança), reconhecendo, em particular e no caso da matemática, esta dualidade nos invariantes geométricos e nos aspectos dinâmicos associados à noção de derivada

sexta-feira, 13 de novembro de 2009

Anúncio português sobre HIV ganha prémio europeu

O anúncio publicitário português "Cinco Razões para não usar preservativo" foi considerado o melhor anúncio governamental europeu de prevenção da sida num concurso internacional, anunciou nesta quinta-feira a Coordenação Nacional para a Infecção VIH/sida.
Para o coordenador nacional para a infecção VIH/sida, citado pela agência Lusa, a atribuição deste prémio é 'muito importante' porque demonstra que 'é possível fazer campanhas que são reconhecidas como interessantes e importantes, quer do ponto de vista da mensagem, quer do ponto de vista estético e da forma como são realizadas'.
Henrique Barros realçou ainda o facto de o prémio ter sido concedido por um júri internacional, no concurso internacional 'European AIDS Video Clip Contest 'Clip & Klar europe 09'', dinamizado pelo governo alemão, em que estavam a ser avaliados anúncios da generalidade dos países europeus.

Fonte: Correio da Manhã

Um recurso para o tema "Patologias e Prevenção" (DR4 do Núcleo "Saúde")

Tópicos de Orientação:

Sociedade: Actuar na prevenção ou resolução de patologias, compreendendo que os riscos, os meios e as concepções de saúde variam entre grupos sociais e entre tempos históricos?

Tecnologia: Actuar tendo em conta a evolução das regras de prevenção e a sua aplicação em situações adequadas, mostrando capacidade de improvisação de meios de protecção?

Ciência: Actuar reconhecendo a evolução do conhecimento científico na forma de melhor enfrentar os agentes causadores de doenças, as suas variantes e o aparecimento de novas doenças, considerando a inferência como um processo importante neste domínio?

sábado, 7 de novembro de 2009

Internet na Idade da Pedra

Um pouco de humor sobre a internet, recebido através de e-mail.



















































.
.
--
Sociedade: Actuar na sociedade da informação, identificando novas oportunidades de participação, bem como mecanismos de desigualdade, resultantes da (des)articulação entre redes tecnológicas e redes sociais.
.
Tecnologia: Actuar tendo em conta o desenvolvimento dos modos de transmissão de informação ao longo da História, relacionando-o com a evolução das estruturas sociais, a ocupação do território, etc. (por exemplo, a rede de televisão, a internet, etc.).
.
Ciência: Actuar em relação à evolução dos conhecimentos científicos na construção das redes (por exemplo, a estrutura celular dos telemóveis, o uso da base binária na internet).

quinta-feira, 29 de outubro de 2009

40º Aniversário do E-mail

A primeira mensagem de correio electrónico entre dois computadores (e-mail em rede) situados em locais distantes foi enviada a 29 de Outubro de 1969, quase dois meses depois do primeiro nó que deu origem à Internet.

O texto dessa primeira mensagem continha apenas duas letras e um ponto - "LO.". O investigador da Universidade da Califórnia em Los Angeles (UCLA) Leonard Kleinrock queria escrever "LOGIN", mas o sistema foi abaixo a meio da transmissão.

A mensagem seguiu do computador do laboratório de Kleinrock na UCLA para o de Douglas Engelbart no Stanford Research Institute, utilizando como suporte a recém-criada rede da ARPA (Advanced Research Projects Agency), agência financiada pelo governo norte-americano.

O primeiro nó de ligação entre dois computadores da Arpanet tinha sido estabelecido pouco tempo antes, em 02 de Setembro de 1969, pelo que a história da Internet e do e-mail em rede se confundem.

No início da década de 1960, surgiram alguns sistemas de troca de mensagens entre terminais de um mesmo computador, em tempo diferido (1961) e em tempo real (1965), mas o primeiro e-mail em rede foi transmitido apenas em 1969.

Dois anos depois, em 1971, Ray Tomlinson inventou os primeiros programas para envio de e-mails em rede através da Arpanet e criou a arroba ("at", em Inglês - @) para separar o login do utilizador do domínio do servidor.

Em 1976, a rainha de Inglaterra, Isabel II, enviou o seu primeiro e-mail, e em 1978 surgiu o primeiro spam, entendido como mensagem de correio electrónico enviada para múltiplos destinatários sem consentimento destes.

Quarenta anos depois, 70 por cento dos e-mails enviados diariamente são "spam", uma "praga" que acompanha o crescimento dos vírus e do marketing na Internet, mas que tem sido combatida, com relativo sucesso, por diversos sistemas de filtragem entretanto desenvolvidos.
O "spam" não é, contudo, o único adversário do e-mail, que encontra cada vez mais concorrentes noutros sistemas de comunicação de texto, áudio e vídeo, de envio de ficheiros e de troca de mensagens instantâneas, através de ferramentas como o Messenger, Skype e Twitter, a que se juntará em breve o Google Wave.
"Pela sua formalidade, o e-mail é algo pouco apelativo para os utilizadores mais jovens. Os blogs e o Twitter ocupam um espaço menos informal", disse à agência Lusa Libório Silva, autor do livro sobre correio electrónico mais vendido em Portugal, "e-mail", editado em 2008.
Libório Silva afirmou que o e-mail continua a ser uma ferramenta em expansão em todo o Mundo, pela facilidade de utilização e pela capacidade de envio de ficheiros associados a mensagens.
Libório Silva destacou como principal ruptura na história do e-mail o surgimento dos serviços de webmail, que são actualmente líderes de mercado entre utilizadores individuais, mas não nas empresas, que continuam a preferir servidores internos.
Outro momento importante foi o surgimento do e-mail da Google (gmail), oferecendo um gigabyte de capacidade, quando os serviços de então ofereciam apenas quatro megabytes, "250 vezes menos".
Apesar de popular, o e-mail continua a ser utilizado pela esmagadora maioria das pessoas sem certificados digitais de segurança, pelo que cada mensagem pode ser interceptada por "um qualquer técnico de informática que tenha acesso a um dos 'routers' por onde passa".
"Mais de 99 por cento dos e-mails são como postais, sem terem envelope por fora", comparou Libório Silva, realçando que só um por cento são "cartas lacradas".
Outros dos pioneiros da Internet em Portugal, Vítor Magalhães, disse à Lusa que "o e-mail continua a ser a funcionalidade da Internet que mais se mantém e que tem tido um desenvolvimento normal", sendo os fóruns de discussão e o Twitter "alternativas e não concorrentes".
Para Vítor Magalhães, "a tentativa da Google de destruir o e-mail através do Google Wave" não deverá ter o sucesso que a empresa prevê, porque o novo serviço contém o mesmo mecanismo e funcionalidade básica do e-mail, de comunicação textual e de transferência de conteúdo multimédia, pelo que não há uma mudança de conceito.



--

quarta-feira, 28 de outubro de 2009

Uma verdade mais que inconveniente

Um recurso para o núcleo: Ambiente e Sustentabilidade (STC2)
Documentário "Uma Verdade mais que Inconveniente"

Um documentário feito pelo "Partido dos Animais" da Holanda. É a resposta ao "An Inconvenient Truth" de Al Gore, que trata de algumas das causas do aquecimento global, poluição e outros problemas globais, mas deixa a questão da pecuária de lado (por motivos políticos). A pecuária é a maior responsável por essa devastação. Acha isso loucura? Assista!




quinta-feira, 22 de outubro de 2009

ECDL - Carta Europeia de Condução em Informática

O que é a ECDL?
(Clique na imagem para mais informações)

A ECDL é uma certificação internacional de competências nas TIC, para utilizadores, orientada para o mercado de trabalho, que atesta que o seu detentor possui as competências e conhecimentos que lhe permitem utilizar eficaz e produtivamente as principais aplicações informáticas para PC.

Como se obtém?

A ECDL obtém-se a partir da realização de 7 exames (correspondentes aos 7 módulos que a constituem), que incidem sobre as 7 principais áreas das TIC mais comummente utilizadas no mercado de trabalho, nomeadamente:

1-Introdução à Informática,
2-Utilização do Computador e Gestão de Ficheiros,
3-Processador de Texto,
4-Folhas de Cálculo,
5-Bases de Dados,
6-Apresentações
7-Internet e Correio Electrónico.


A quem se destina

A ECDL é uma Certificação independente da idade, das habilitações académicas, do estatuto social e da experiência ou formação em informática.

Destina-se as todas as pessoas que utilizem ou venham a utilizar o computador no seu dia-a-dia, seja a título profissional ou pessoal, seja um não especialistas ou um Licenciado em Sistemas de Informação e Comunicação.

Reconhecida por quem?

Com um padrão de competências definido e reconhecido internacionalmente, a Certificação ECDL assegura aos seus detentores a mobilidade do reconhecimento das suas competências em toda a Europa e nos cerca de 150 países dos 5 continentes onde a ECDL se encontra implementada.

Identificada a nível nacional como Carta Europeia de Condução em Informática a ECDL - European Computer Driving Licence assume-se como a Carta de Condução para as Auto-estradas da Informação e Conhecimento, tendo como principais objectivos:
  • Ultrapassar a designação vaga e comum utilizada nos curriculum vitae "Conhecimentos de Informática na Óptica do Utilizador" e garantir um padrão objectivo de competências;

  • Promover uma melhor utilização dos equipamentos informáticos e consequentemente a produtividade dos colaboradores das Empresas e Entidades públicas e privadas, assim como a rentabilização dos investimentos em TIC;

  • Validar competências e conhecimentos no domínio das TIC, através de um Certificado reconhecido em toda a Europa e Internacionalmente em cerca de 150 países.


Rede de Centros:

Clique Aqui


No Distrito de Castelo Branco

Castelo Branco

FDTI – CDTI de Castelo Branco
IPJ - Rua Dr. Francisco José Palmeiro
6000-230 Castelo Branco
Tel: 272 323703/348000
Fax: 272 348007/09
Email:
jaime.barata@fdti.pt
Contacto: Dr. Jaime Manuel Henriques Barata


Covilhã

CILAN
Rua Dr. Júlio Maria da Costa, nº 25
6200-130 Covilhâ
Tel: 275 320 300
Fax: 275 320309
Email:
cilan@mail.telepac.pt
Web:
http://www.cilan.pt/
Contacto: Engª Maria João Garret



Fonte: http://www.ecdl.pt/index.php?option=com_content&task=view&id=22&Itemid=25

quinta-feira, 15 de outubro de 2009

O Elemento (Hereditariedade)

A hereditariedade corresponde ao conjunto de processos biológicos que asseguram que cada ser vivo receba e transmita informações genéticas, através da reprodução. As informações genéticas determinam as características de um indivíduo e até a espécie à qual pertence. As características como a cor do cabelo, a estatura, o temperamento e a susceptibilidade para doenças são algumas das informações herdadas aquando da concepção. (Wikilivros)



sábado, 10 de outubro de 2009

O Elemento (Material Genético)

O ácido desoxirribonucleico (ADN, em português: ácido desoxirribonucleico; ou DNA, em inglês: deoxyribonucleic acid), é um composto orgânico cujas moléculas contêm as instruções genéticas que coordenam o desenvolvimento e funcionamento de todos os seres vivos e alguns vírus. O seu principal papel é armazenar as informações necessárias para a construção das proteínas e ARNs. Os segmentos de ADN que são responsáveis por carregar a informação genética são denominados genes. O restante da seqüência de ADN tem importância estrutural ou está envolvido na regulação do uso da informação genética.
Fonte: Wikipédia


sábado, 3 de outubro de 2009

Estrutura ADN

O ADN, Ácido DesoxirriboNucleico, é uma molécula biológica universal presente em todas as células vivas. É no ADN que está contida toda a nossa informação genética, sob a forma de genes. O ADN é constituído por quatro tipos de nucleótidos , unidade básica do ADN (que por sua vez é constituído por uma pentose, um grupo fosfato e uma base azotada), que se associam de uma forma específica, formando uma cadeia dupla: adenina (A) com timina (T) e guanina (G) com citosina (C). Os nucleótidos são designados deste modo devido às bases azotadas que entram nas suas constituições. É possível ler a cadeia de ADN, obtendo-se uma sequência de letras, como por exemplo, ATGATTCTGTAGCCTGATCCC, a uma sequência completa de ADN dá-se o nome de genoma.
O ADN tem a forma de uma escada de corda enrolada helicoidalmente, ou seja, de uma hélice dupla em que os degraus são formados por pares de bases azotadas ligadas entre si, através de ligações de hidrogénio, com fundamento na complementaridade de bases. A estrutura, do ADN, foi proposta há 53 anos por James Watson e Francis Crick. A descoberta da estrutura do ADN abriu o caminho para se compreender como é que a informação genética é transmitida de progenitores para descendentes, ou de uma célula para outra, isto é, como funciona a hereditariedade.

http://www.notapositiva.com/trab_estudantes/trab_estudantes/biologia/biologia_trabalhos/adn.htm



domingo, 13 de setembro de 2009

Computador (NG5 - DR2)

"As TIC são utilizadas pelos organismos da administração pública, empresas, famílias e indivíduos.
A rápida difusão das TIC exerce mutações no modo de vida das sociedades. Assume importância na vida colectiva e individual actual.
A tecnologia tem origem na sociedade, exercendo uma influência decisiva no seu desenvolvimento. A sociedade portuguesa tem usufruído dessas tecnologias, na administração pública, central e local e na estrutura empresarial portuguesa.
A vantagem da difusão das TIC contribuiu para simplificar processos administrativos e proporcionar a redução dos custos que lhe estão associados. Contribuindo também a agilização do relacionamento com os cidadãos e empresas.
A principal forma de interacção com os cidadãos e a tecnologia é a existência de canais direccionados para sugestões e reclamações on-line, pagamentos e preenchimento de formulários/declarações."

Fonte: http://www.notapositiva.com/trab_estudantes/trab_estudantes/tic/10importanctic.htm






Sociedade: Actuo em novas formas de aquisição de competências face às TIC, compreendendo os seus usos nas organizações e relacionando-os com as literacias e qualificações exigidas aos profissionais na sociedade da informação.
Tecnologia: Actuo na esfera da vida profissional promovendo o recurso às tecnologias de suporte às TIC (micro electrónica, ecrãs, etc.).
Ciência: Actuo na vida profissional, com conhecimentos científicos básicos de funcionamento dos equipamentos de suporte às TIC (por exemplo, o computador, o monitor de cristais líquidos, a aritmética binária, etc.).

terça-feira, 25 de agosto de 2009

O futuro dos Telemóveis

Samsung e Sprint apresentam telemóvel biodegradável

Estas duas empresas estão unidas pelo ambiente, daí o lançamento de um novo telemóvel que é biodegradável, contendo um grande percentagem de materiais recicláveis e ainda 40% de derivados de milho.
O seu teclado QWERTY deslizante é feito de bio-plástico com materiais derivados de milho, não contendo qualquer derivado de PVC ou BFR. Está equipado ainda com uma câmara de 2 megapixéis, Bluetooth, GPS, slot para cartões microSD até 32GB e ainda tem abordo o Sprint Navigation.

Obviamente que a caixa também teria de ser feita de material reciclável, com otambém a tinta que é à base de soja. A venda do Samsung Reclaim nos EUA começa a 16 de Agosto e o custo será de 49,99$ (34€), no entanto este equipamento não chegará a Portugal por nenhuma operadora, pois é um modelo exclusivo da Sprint.

Tópicos de Reflexão:
iii) Explore evoluções futuras no uso dos telemóveis (por exemplo, biologização dos equipamentos) e discutir as suas consequências, positivas e negativas, nas relações e práticas sociais.

sábado, 15 de agosto de 2009

Boas Férias

Votos de umas excelentes férias a todos os visitantes deste espaço.

Deixo, como sugestão de férias, uma exploração deste país fantástico "à beira mar plantado".


Conheça melhor algumas das regiões, clicando na imagem abaixo:

http://minhasorigens.no.sapo.pt/PPS%20Portugal.html

Boas Férias e Até Breve! :)

sábado, 8 de agosto de 2009

quarta-feira, 8 de julho de 2009

Web 2.0

Um recurso para Redes e Tecnologias (NG5 - DR4)

Socializar On-line
(fonte: aqui)
“Os muito milhões que se ligam a como o Facebook, Twitter, Myspace, Hi5 e outros, querem dizer ao mundo o que andam a fazer, quem são e o que pensam. Defendem ideais, exibem preferências, juntam-se a grupos, alguns com (muita) influência. Uma nova forma de vida, na internet, a que, provavelmente, nenhum dos que vivem no mundo real conseguirá escapar”

por: João Dias Miguel – in Visão.

Viver na Rede
A visão publicou um artigo (26.03.2009) muito interessante e recomendado, sobre o mundo virtual que a população cibernauta está a viver. Neste momento milhões de utilizadores estão ligados entre si através das diversas redes sociais existentes, mostram o seu trabalho, divulgam as suas ideias, fazem amigos etc. O fundamental é que, sem dúvida alguma as redes sociais são um excelente meio de divulgação e principalmente gratuito, quantos de nós, temos uma costela artística e nunca nos apresentamos ao mundo pois os custos são elevados ou o nosso trabalho nunca foi reconhecido, talvez não tenha contactado com as pessoas certas, o facto é que desta forma o nosso público é o mundo! Claro que as redes sociais têm dois lados, o positivo pois alargamos o nossa vida pessoal e profissional a um role de pessoas quase infinito e claro a desvantagem de a nossa vida passar quase em directo na internet.


O Facebook

“Quando, no pequeno subúrbio de Cambridge, em Boston, Mark Zuckerberg, o hoje multimilionário dono e administrador executivo do Facebook, teve a ideia de criar uma rede social on-line, juntamente com os seus dois companheiros de quarto, afirmou que pretendia dar às pessoas a possibilidade de replicarem na internet aquilo que fazem todos os dias na vida real. E o que fazemos no dia-a-dia? Chocamos com um velho amigo e ficamos horas a falar com ele. Pegamos no álbum de fotografia da família e demoramo-nos a recordar tempos passados com aquele primo que convidámos para ir jantar lá em casa. Vemos filmes. Ouvimos músicas. Juntamo-nos a clubes ou associações. Brincamos.
Esta constitui talvez, ainda hoje, a melhor forma de o narrar: é um lugar virtual onde nos juntamos e começamos a socializar, a falar, a aderir a grupos do nosso interesse…”
“No seu sonho, Zuckerberg queria apenas reunir os companheiros de Harvard numa rede onde todos pudessem conversar… ”
Desde que foi criado em 2004 o Facebook começou a crescer e já tem cerca de mil empregados.
Zuckerberg concretizou o seu sonho.


A Era 2.0

Até há bem pouco tempo, socializar não passava de trocar uns e-mails com os amigos, conversar era num software chamado Mirc.
Com a introdução da banda larga tudo mudou, começamos a navegar em velocidade galáctica, a estar sempre disponíveis online, seja no computador ou no telemóvel. A nossa vida passou a estar ligada à internet, quase como um pacemaker, é através dela que contactamos como os nosso amigos, utilizamos o voip para falar, o telemóvel para socializar.
Sem dúvida que a Web2.0 marcou as redes sociais, sem ela não teríamos esta velocidade estonteante para comunicar.


As principais Redes Sociais:

Myspace

Quando? Criado em 2003.
Quantos? 114 Milhões de utilizadores e 230 mil novos registos por dia.
Para quem? Utilizado maioritariamente por músicos e fãs.
Para quê? Excelente para contornar a máquina industrial do mundo da música. Autopromoção e marketing em massa. Apurar modas e tendências entre os jovens utilizadores.

Facebook

Quando? Criado em 2004.
Quantos? 124 Milhões de utilizadores e 250 mil novos registos por dia.
Para quem? A partir dos 25 anos.
Para quê? Rede de contactos pessoais, mas também utilizado por políticos, estrelas da música e outras celebridades, com vista à autopromoção. As empresas promovem acções de marketing. Tendências e modas passam por aqui.


HI5
Quando? Criado em 2003.
Quantos? 70 Milhões de utilizadores e 350 mil novos registos por dia.
Para quem? É a principal rede social em de 25 países de diversos continentes. É utilizado especialmente pelos jovens.
Para quê? Criação de comunidades, promoção de celebridades e acções de marketing.

Orkut

Quando? Criado em 2004.
Quantos? 120 Milhões de utilizadores.
Para quem? Tem uma comunidade indistinta de utilizadores, muito localizada na Índia, EUA e Brasil.
Para quê? Criação de comunidades, manutenção e alargamento da rede de contactos, assim como promoção de celebridades, musica e produtos.
Twitter
Quando? Criado em 2006.
Quantos? 2 Milhões de utilizadores e 3500 novos registos por dia.
Para quem? Internautas que passam muitas horas ligados à Internet. Trata-se de um sistema de microblogging. Para quem quer estar hiperligado ao que os outros fazem.
Para quê? Manutenção e expansão da rede de contactos e criação de comunidades virtuais.
Linked in

Quando? Criado em 2003.
Quantos? 25 Milhões de utilizadores.
Para quem? Profissionais empreendedores, empresários. É a rede mais “séria” deste grupo.
Para quê? Utilizada para alargar a rede de contactos, a busca de novas oportunidades de negócio e aconselhamento de gestão.
fonte: Livro 33 Million People in the Room, de Julliete Powel






Sociedade: Actuar na sociedade da informação, identificando novas oportunidades de participação, bem como mecanismos de desigualdade, resultantes da (des)articulação entre redes tecnológicas e redes sociais.
Tecnologia: Actuar tendo em conta o desenvolvimento dos modos de transmissão de informação ao longo da História, relacionando-o com a evolução das estruturas sociais, a ocupação do território, etc. (por exemplo, a rede de televisão, a internet, etc.).
Ciência: Actuar em relação à evolução dos conhecimentos científicos na construção das redes (por exemplo, a estrutura celular dos telemóveis, o uso da base binária na internet).

sábado, 4 de julho de 2009

Origem do Universo - NG7 - DR4

Génio da Física fala sobre a origem do Universo e sobre a possível existência de vida no Universo.

Um possível recurso para o tema "Leis e Modelos Cientificos"



Sociedade: Actuar perante fenómenos sociais complexos, concebendo-os como resultado de evoluções históricas e adoptando configurações diversas consoante as sociedades e/ou os grupos sociais.
Tecnologia: Actuar de forma a compreender que as soluções técnicas têm validade limitada e que têm tendência a mudar, tal como muda a ciência e a própria sociedade.
Ciência: Actuar tendo em conta que se vive num mundo onde coexistem leis científicas de invariância (que valorizam a estabilidade) e leis científicas de evolução (que apontam para a mudança), reconhecendo, em particular e no caso da matemática, esta dualidade nos invariantes geométricos e nos aspectos dinâmicos associados à noção de derivada.

domingo, 28 de junho de 2009

NG6 - DR3 - Administração, Segurança e Território

--------------------------------------------------------------------------
Mobilizar informação sobre o papel das diferentes instituições no âmbito da administração, segurança e território.
--------------------------------------------------------------------------------

"A segurança rodoviária interessa a todos os cidadãos. Todos têm um importante papel a desempenhar para tornar as estradas mais seguras. Não obstante a eficácia das acções já realizadas, na União Europeia o número de vítimas das estradas continua a ser demasiado elevado: 1,3 milhões de acidentes rodoviários por ano que provocam 43 000 mortos e 1,7 milhões de feridos. O comportamento dos condutores é, reconhecidamente, a primeira causa dos acidentes mortais: velocidade, consumo de álcool ou droga, cansaço, falta de cinto de segurança ou capacete, etc.
Este problema tem sido alvo de atenção crescente em toda a UE, tendo sido proposta uma meta ambiciosa: reduzir em 50% o número de vítimas até 2010 em relação a 2001. Para alcançar esta meta, é necessária uma abordagem sistemática."

Fonte: http://ec.europa.eu/health-eu/my_environment/road_safety/index_pt.htm
Tópicos de Reflexão:

Sociedade:

  1. Identificar diferentes instituições que regulam a rede rodoviária nacional (por exemplo, Direcção-Geral de Viação, Instituto das Estradas de Portugal, Brigada de Trânsito, concessionários de exploração das auto-estradas, etc.).

  2. Compreender como as diferentes instituições têm poderes, campos de actuação e modos de regulação distintos (por exemplo, prevenção rodoviária, construção e sinalização de estradas, formulação do código de estrada, medidas de coação, etc.).

  3. Explorar a relação entre o desenvolvimento da rede rodoviária e a transformação da densidade e aglomeração populacional dos territórios.

Tecnologia:

  1. Identificar várias técnicas de vigilância, sinalização e segurança rodoviárias de base tecnológica.
  2. Compreender o princípio de funcionamento de equipamento de apoio ao sistema rodoviário (por exemplo, descrevendo o princípio de efeito Doppler utilizado nos radares da polícia, a detecção de um automóvel por um anel indutor no solo, o sistema de detecção de álcool no sangue conhecido vulgarmente como “o balão”, etc.).

  3. Explorar a necessidade das instituições com poderes de coação procederem regularmente à calibração do equipamento de medida com recurso a laboratórios de metrologia creditados.

Ciência:

  1. Identificar diferentes soluções rodoviárias para regulação de fluxos de tráfego recorrendo a grafos e a caminhos ao longo de grafos.

  2. Compreender a função de diferentes soluções rodoviárias na gestão de fluxos, modos de condução, segurança, etc. (por exemplo uma rotunda, diminui a velocidade automóvel e regula a distribuição do tráfego de uma forma participada) e compreender que num grafo a escolha de caminhos não é aleatória.

  3. Explorar as alterações rodoviárias com base em teoria de tráfego para a facilitação do fluxo de tráfego em diferentes momentos do dia (por exemplo, a substituição de cruzamentos por rotundas, a gestão dos tempos dos semáforos, etc.). Decidir entre vários modelos de grafos quais os que apresentam fluxos optimais.

Vídeo: Perigo - Condução ao Telemóvel


Sociedade: Actuar face a instituições reguladoras da administração e segurança do território, compreendendo os seus campos de actuação e modos de regulação.
Tecnologia: Actuar na organização técnica de sistemas administrativos ligados à gestão de serviços relacionados com prevenção e segurança na mobilidade.
Ciência: Actuar utilizando os conhecimentos científicos que suportam normas e códigos reguladores de segurança e administração do território (por exemplo no código rodoviário: controlo de velocidade, restrições em piso molhado, distância mínima entre carros, etc.) e, a um nível mais sofisticado, avaliar da justiça dessa regulamentação tendo em conta os modelos estatísticos e matemáticos que governam a matéria regulada.

sexta-feira, 5 de junho de 2009

Dia Mundial do Ambiente

Comemora-se hoje, 5 de Junho, o Dia Mundial do Ambiente.
"O Dia Mundial do Meio Ambiente foi estabelecido pela Assembleia Geral das Nações Unidas em 1972 marcando a abertura da Conferência de Estocolmo sobre Ambiente Humano. Celebrado anualmente desde então no dia 5 de Junho, o Dia Mundial do Meio Ambiente cataliza a atenção e acção política de povos e países para aumentar a consciencialização e a preservação ambiental. "
São várias as campanhas de sensibilização desde a reciclagem, reutilização e redução de desperdícios, ao apelo à poupança dos recursos naturais, nomeadamente esse recurso tão essencial que é a ÁGUA.
Um excelente recurso para Ambiente e Sustentabilidade.
Clique em cima da imagem e será direccionado ao Youtube, para Visualização


"HOME, filme da autoria do realizador francês Yann Arthus-Bertrand, é constituído por paisagens aéreas do mundo inteiro e pretende sensibilizar a opinião pública mundial sobre a necessidade de alterar modos e hábitos de vida a fim de evitar uma catástrofe ecológica planetária."

terça-feira, 12 de maio de 2009

Impostos (NG4-DR1)

Numa viagem pela internet, encontrei um texto bastante interessante e actual sobre o sistema de impostos, o texto poderá ser visualizado aqui (CLIQUE).


"Para refletir!

Uma explicação do sistema de impostos:


Suponha que a cada dia, um grupo de dez homens reunia para beber uns copos e conversar e que a conta associada para todo o grupo era de 100 euros. Se cada um destes homens pagasse a conta da mesma forma que pagamos os nossos impostos, seria algo do género:

Os primeiros 4 homens (os mais pobres) não pagavam nada
O quinto pagava 1 euro
O sexto pagava 3 euros
O sétimo pagava 7 euros
O oitavo pagava 12 euros
O nono pagava 18 euros
O décimo (o mais rico) pagava 59 euros

De forma a ser mais justo, foi precisamente esta a situação tomada pelo grupo para pagar as despesas do seu encontro diário.

Deste modo o grupo encontrava-se diariamente e pareciam todos bastante satisfeitos com o seu acordo. Até que um dia, o dono do bar onde se reuniam alterou o estado das coisas.

De facto, o dono do bar, constatando que tinha no grupo bons clientes, decidiu reduzir o custo da sua despesa em 20 euros. Desta forma, a despesa comum passou dos 100 euros iniciais para 80 euros.

O grupo pretendeu continuar a pagar a sua despesa da mesma forma que pagamos os nossos impostos. Deste modo, os primeiros quatro homens não foram afectados, pois continuavam a consumir as suas bebidas sem custos. Mas o que acontece com os outros seis homens; os clientes que pagam a conta? Como podem eles dividir os 20 euros, de modo a que cada um deles receba a sua parte justa?

O grupo verificou que os 20 euros divididos por seis permitiam um desconto de 3.33 euros a cada. Mas se subtraíssem essa quantia das contas de todos, o quinto e o sexto homem seriam pagos para tomar as respectivas bebidas. Assim, o dono do bar sugeriu que seria justo que a conta fosse reduzida a cada homem, sensivelmente o mesmo montante, mas assegurando que os valores não fossem negativos. Com base nesses cálculos foi obtida uma nova tabela de pagamentos:

O quinto homem, tal como os primeiros quatro, não pagava nada (100% de poupança)
O sexto homem pagava agora 2 euros em vez de 3 euros (33% de poupança)
O sétimo homem pagava agora 5 euros em vez de 6 euros (28% de poupança)
O oitavo homem pagava agora 9 euros em vez de 10 euros (25% de poupança)
O nono homem pagava agora 14 euros em vez de 18 euros (22% de poupança)
O décimo homem pagava agora 49 euros em vez de 59 euros (16% de poupança)

Cada um dos seis homens estava melhor do que antes e os primeiros quatro continuaram a ter as suas bebidas grátis. Mas uma vez fora do bar, os homens começaram a comparar as suas poupanças:

- "Eu apenas recebo um euro dos 20!", exclamava o sexto homem, e apontando para o décimo homem, afirmava "mas tu recebes 10 euros!".

- "Sim! isso é verdade", afirmou por sua vez o quinto homem e continuou: "Eu apenas poupo um euro, também. Não é justo que ele receba dez vezes mais do que eu recebo...".

- "É verdade!!!" - gritou o sétimo homem, acrescentando: "porque razão recebe ele 10 euros, quando eu apenas recebo 2? O homem rico tem sempre todos os benefícios!".

- "Esperem um momento", disseram ao mesmo tempo, os primeiros quatro homens: "Nós não recebemos absolutamente nada. O sistema explora o pobre!".

Assim, o nono homem aproximou-se do décimo e tocou-lhe nas costas como querendo partilhar a sua não concordância com os demais.

Na noite seguinte, o décimo homem não apareceu para as bebidas (foi uma surpresa...), pelo que os nove homens decidiram mesmo assim reunir como de costume e beber eles mesmos.

Mas, na altura de pagar a conta, descobriram algo de muito importante: não tinham dinheiro suficiente para o fazer! Mesmo entre todos, não chegava para pagar metade da conta.

É assim que o nosso sistema de impostos funciona!
As pessoas que pagam as maiores taxas também têm o maior benefício de uma redução de impostos.

Se forem demasiadas as taxas de impostos, se os que possuem mais recursos forem atacados por isso mesmo, podem deixar de aparecer para pagar as bebidas.


Fim de estória!

Para os que entendem, nenhuma explicação adicional é necessária.
Para aqueles que não entendem, nenhuma explicação é possível.

-------------
Enfim, durinho, mas que dá que pensar, dá..."





Tópicos de Reflexão:


  1. Identifico diferenças nos rendimentos médios das famílias consoante as suas actividades profissionais

  2. Compreendo as diferentes categorias de rendimentos das famílias e a estrutura de tributação fiscal relacionando-as com as respectivas origens (por exemplo, no caso de declaração IRS: o trabalho por conta de outrem _ A; trabalho independente _ B; predial – H; mais-valias – G).

  3. Exploro diferentes formas de conseguir combater a evasão fiscal com vista a uma maior justiça social (por exemplo, cruzamento de dados através de sistemas informáticos).

sábado, 9 de maio de 2009

Dia da Europa - 9 de Maio (NG4-DR3)


Comemora-se, hoje, o Dia da Europa.
No dia 9 de Maio de 1950, Robert Schuman, ministro dos Negócios Estrangeiros francês, profere um importante discurso, inspirado num plano de Jean Monnet, através do qual propõe que a França e a República Federal da Alemanha ponham em comum os seus recursos de carvão e de aço, numa organização aberta a outros países da Europa.
Reconhecendo a importância da data que marcou o início do processo de construção europeia, os chefes de Estado e de Governo decidiram, na cimeira de Milão de 1985, consagrar o dia 9 de Maio como o Dia da Europa.
-
"Ao verem nas agendas e nos calendários o dia 9 de Maio identificado como "Dia da Europa", muitas pessoas interrogam-se sobre o que se terá passado nessa data e em que ano terá tido lugar esse acontecimento.
.
Com efeito, poucos cidadãos europeus sabem que a 9 de Maio de 1950 nasceu a Europa comunitária, numa altura em que, devemos recordá-lo, a perspectiva de uma terceira guerra mundial angustiava toda a Europa.
.
Nesse dia, em Paris, a imprensa foi convocada para as dezoito horas no Salon de l'Horloge do Quai d'Orsay, quartel-general do Ministério dos Negócios Estrangeiros francês, para uma "comunicação da maior importância".
.
As primeiras linhas da declaração de 9 de Maio de 1950, redigida por Jean Monnet, comentada e lida à imprensa por Robert Schuman, Ministro dos Negócios Estrangeiros da França, dão imediatamente uma ideia da ambição da proposta: "A paz mundial não poderá ser salvaguardada sem uma criatividade à medida dos perigos que a ameaçam". "Através da colocação em comum de produções de base e da instituição de uma Alta Autoridade nova, cujas decisões ligarão a França, a Alemanha e os países que a ela aderirem, esta proposta constituirá a primeira base concreta de uma federação europeia, indispensável à preservação da paz".
.
Era assim proposta a criação de uma instituição europeia supranacional, incumbida de gerir as matérias-primas que nessa altura constituíam a base do poderio militar, o carvão e o aço. Ora, os países convidados a renunciar desta forma ao controlo exclusivamente nacional destes recursos fundamentais para a guerra, só há muito pouco tempo tinham deixado de se destruir mutuamente num conflito terrível, de que tinham resultado incalculáveis prejuízos materiais e, sobretudo, danos morais: ódios, rancores e preconceitos.
.
Assim, tudo começou nesse dia, razão que levou os Chefes de Estado e de Governo, na Cimeira de Milão de 1985, a decidirem celebrar o 9 de Maio como "Dia da Europa".
.
Os diversos países, ao decidirem democraticamente aderir à União Europeia, adoptam os valores da paz e da solidariedade, pedra angular do edifício comunitário.
.
Estes valores concretizam-se no desenvolvimento económico e social e no equilíbrio ambiental e regional, únicos garantes de uma repartição equilibrada do bem-estar entre os cidadãos.
.
A Europa, enquanto conjunto de povos conscientes de pertencerem a uma mesma entidade que abrange culturas análogas ou complementares, existe já há séculos. No entanto, a consciência desta unidade fundamental, enquanto não deu origem a regras e a instituições, não pôde evitar os conflitos entre os países europeus. Ainda hoje, alguns países que não fazem parte da União Europeia não estão ao abrigo de tragédias terríveis. .

Como qualquer obra humana desta envergadura, a integração da Europa não se constrói num dia, nem em algumas décadas: as lacunas são ainda numerosas e as imperfeições evidentes. A construção iniciada imediatamente a seguir à II Guerra Mundial foi muito inovadora: o que nos séculos ou milénios precedentes podia assemelhar-se a uma tentativa de união, foi na realidade o fruto de uma vitória de uns sobre os outros. Estas construções não podiam durar, pois os vencidos só tinham uma aspiração: recuperar a sua autonomia.
-
Hoje ambicionamos algo completamente diferente: construir uma Europa que respeite a liberdade e a identidade de cada um dos povos que a compõem, gerida em conjunto e aplicando o princípio segundo o qual apenas se deve fazer em comum o que pode ser mais bem feito dessa forma. Só a união dos povos pode garantir à Europa o controlo do seu destino e a sua influência no mundo.
-
A União Europeia está atenta aos desejos dos cidadãos e coloca-se ao seu serviço. Conservando a sua especificidade, os seus hábitos e a sua língua, todos os cidadãos se devem sentir em casa na "pátria europeia", onde podem circular livremente."











Tópicos de Reflexão:

Sociedade: Actuo no sistema económico, monetário e financeiro, reconhecendo novos problemas e oportunidades geradas pelas interacções que se estabelecem a nível global, e em particular, no contexto da União Europeia, e seus efeitos no bem-estar e progresso social.

Tecnologia: Actuo ao nível das tecnologias relacionadas com o conhecimento e a segurança de diferentes meios de transacção e na comunicação com instituições económicas e financeiras.

Ciência: Actuo com conhecimento dos indicadores macroeconómicos tendo em conta que os problemas económicos envolvem politicas monetárias, e considerando a utilização de modelos matemáticos que permitam simular e prever diversas situações.

sexta-feira, 1 de maio de 2009

1º de Maio - Dia do Trabalhador (NG4-DR4)


1.º de Maio - Dia do Trabalhador

Todos os anos, no dia 1 de Maio, comemora-se, em todo o mundo, o Dia do Trabalhador.

As origens do Dia do Trabalhador não são muito recentes. A história deste dia começa no séc. XIX.

Nessa época, abusava-se muito dos trabalhadores, porque chegavam a trabalhar entre 12 e 18 horas por dia, o que era muito cansativo e até prejudicial à saúde!

Já há algum tempo que os reformadores sociais (aqueles que propunham reformas, ou seja, mudanças na sociedade) defendiam que o ideal era dividir o dia em três períodos: 8 horas para trabalhar, 8 horas para dormir e 8 horas para o resto, o que incluía a diversão.

Foi com o objectivo de lutar pelas 8 horas de trabalho diárias que, no dia 1 de Maio de 1886, milhares de trabalhadores de Chicago (EUA) se juntaram nas ruas para protestar contra as suas más condições de trabalho.

A manifestação devia ter sido pacífica, mas as forças policiais tentaram pará-la, o que resultou em feridos e mortos.

Este acontecimento ficou conhecido como "os Mártires de Chicago", por causa das pessoas que foram feridas e mortas só por estarem a lutar pelos seus direitos.

Quatro dias depois, houve uma nova manifestação pela redução do horário de trabalho e melhores condições.

Mais uma vez, a polícia virou-se contra os manifestantes e acabou por prender 8 pessoas, 5 das quais foram condenadas à forca!

Como o povo estava cada vez mais revoltado, estas condenações só serviram para "deitar mais achas na fogueira" e despertar a atenção de todo o mundo.

Em 1888, dois anos depois destes acontecimentos, os presos foram libertados por um júri que reconheceu que os trabalhadores estavam inocentes.

Em 1889, o Congresso Internacional em Paris decidiu que o dia 1 de Maio passaria a ser o Dia do Trabalhador, em homenagem aos "mártires de Chicago".

Só em 1890, os trabalhadores americanos conseguiram alcançar a sua meta das 8 horas de trabalho diárias!

Em Portugal, devido ao facto de ter havido uma ditadura durante muito tempo, só a partir de Maio de 1974 (o ano da revolução do 25 de Abril) é que se passou a comemorar publicamente o Primeiro de Maio.

Sabia que só a partir de Maio de 1996 é que os trabalhadores portugueses passaram a trabalhar 8 horas por dia?

Tópicos de Reflexão:

Sociedade: Actuo nos usos e na gestão do tempo, compreendendo que os diferentes elementos do sistema económico variam consoante os sectores de actividade e estão em permanente evolução ao longo do tempo.

  1. Identifico como a duração da jornada de trabalho diária evolui ao longo dos tempos e varia de acordo com as actividades económicas (por exemplo, agricultura vs industria vs serviços, etc.).
  2. Relaciono a regulação da jornada de trabalho com lutas sociais, políticas públicas e evoluções tecnológicas.
  3. Exploro o sentido das transformações nas noções sociais de tempo ao longo do processo de industrialização.

Tecnologia: Actuo tendo em conta as tecnologias existentes na gestão do tempo (por exemplo, o transporte aéreo versus a vídeo conferência).

Ciência: Actuo ao nível da gestão do custo do tempo compreendendo a evolução ao longo da história e tendo em conta factores diversos tais como o custo da hora de salário, encargos socais e amortização de equipamentos, considerando uma vez mais as potencialidades da matemática na simulação de situações alternativas tendo em vista a procura de soluções optimais.

sábado, 25 de abril de 2009

Crise do Subprime (NG4 - DR3)

Um vídeo simples, que explica a crise do subprime.

Um excelente recurso para o Núcleo Gerador 4 - Gestão e Economia, no tema Sistemas Monetários e Financeiros.




The Crisis of Credit Visualized from Jonathan Jarvis on Vimeo.

sábado, 18 de abril de 2009

A Quinta do Futuro (NG6 - DR2)

Um recurso para Urbanismo e Mobilidade

"Aproveita a energia do vento, do sol e produz biogás com os detritos animais e domésticos. Gera hidrogénio com que alimenta as máquinas agrícolas. Esta é a proposta da empresa New Holland Agriculture, que acaba de ser premiada em Paris pela inovação."

Expresso Multimédia


terça-feira, 14 de abril de 2009

NG6 - DR2 - Ruralidade e Urbanidade

"A Agricultura Biológica é um modo de produção agrícola que respeita o meio ambiente e a biodiversidade, recorrendo a técnicas de produção menos agressivas e mais preventivas do que as utilizadas na agricultura convencional.

Este tipo de agricultura utiliza somente químicos naturais, contribuindo assim para alimentos mais saudáveis que podemos encontrar em inúmeros pontos de venda: frutos, legumes, hortícolas, vinhos, cereais, pão, azeite...

Enquanto consumidores, devemos exigir o melhor para a nossa saúde e para o ambiente.
Ao optarmos por alimentos provenientes da agricultura biológica estamos a contribuir para a redução da quantidade de agroquímicos tóxicos na nossa alimentação e, simultaneamente, para o desenvolvimento de um modo de produção agrícola mais sustentável."

Tópicos de Reflexão:

Sociedade:
  1. Identifico profissões ou ocupações profissionais relacionadas com a produção agrícola.

  2. Compreendo a evolução recente das actividades económicas e produtivas em Portugal e relacioná-las com a alteração de inserções profissionais e modos de vida das populações de certas regiões (por exemplo: o Alentejo ou a Região Oeste).

  3. Exploro novos modos de evolução das actividades agrícolas como factor de desenvolvimento regional (por exemplo: a agricultura biológica ou culturas de produtos tradicionais que entram nas quotas da Política Agrícola Comum da União Europeia).

Tecnologia:

  1. Identifico produtos químicos adequados a diversas intervenções (fertilizantes, herbicidas, fungicidas), equipamentos agrícolas e respectivas aplicações.

  2. Compreendo a adopção de diferentes técnicas agrícolas em função de diferentes culturas e ambientes, relacionando algumas práticas agrícolas com mecanismos de prevenção e redução de danos por contaminação química ou biológica (por exemplo, rotação de culturas e cultivos mistos, análise de solos, utilização correcta dos prazos de tratamento elativamente a colheitas, distância segura em culturas transgénicas em relação a outras culturas, etc.).

  3. Exploro a produção de novas agriculturas, tais como agricultura biológica, produtos transgénicos e/ou geneticamente modificados, tendo em conta vantagens e inconvenientes.

Ciência:

  1. Identifico etapas do ciclo do azoto (fixação de azoto pelas leguminosas, incorporação pelas plantas, transferência para os animais, etc.).

  2. Compreendo a acção das bactérias das raízes das leguminosas e dos solos nas reacções de transformação dos compostos azotados.

  3. Exploro os mecanismos biológicos de transformação de compostos azotados relacionando-os com a utilização de estrumes orgânicos e de fertilizantes inorgânicos (por exemplo, degradação da ureia nas pastagens ou nos estrumes e formação de nitritos por acção das bactérias dos solos, etc.).





Sociedade: Actuo ao nível das dinâmicas de desenvolvimento local e regional, em contextos urbanos e rurais, compreendendo a evolução das actividades económicas e os processos de transformação sociocultural num dado território, relacionando-as com as mudanças nas profissões e nos modos de vida das populações.
Tecnologia: Actuo na exploração dos recursos naturais (zonas de agricultura, piscatórias, mineiras), ou nos locais de grande comercialização e consumo (centros urbanos), com conhecimento dos meios técnicos adequados, tradicionais ou inovadores.
Ciência: Actuo na vida profissional com conhecimento do modo de actuação dos processos químicos, biológicos e técnicos de produção, em zonas rurais ou urbanas, de modo a salvaguardar e manter o equilíbrio no ambiente e no bem-estar das diferentes comunidades.

sexta-feira, 10 de abril de 2009

Votos de uma Feliz Páscoa

Francês: JOYEUSES PÂQUES; Alemão: SCHÖNE OSTERN; Espanhol: FELICES PASCUAS; Italiano: BUONA PASQUA; Macedônio: SREKEN VELIGDEN; Inglês: HAPPY EASTER; Grego: KALO PASKA; Chinês: FOUAI HWO GIE QUAI LE; Árabe: EID-FOSS'H MUBARAK; Croata: SRETUN USKRS; Húngaro: Boldog Husveti Ünnepeket; Polonês: Wesolych Swiat; Sueco: Glad Påsk; Holandês: Gelukkig Paasfest; Norueguês: God Påske; Turco: Mutlo (eller Hos) Paskalya;


Português: Feliz Páscoa

domingo, 5 de abril de 2009

365 dias após a primeira publicação ...

Este blog completa hoje um ano de existência. Durante estes 12 meses, este Blog teve cerca de 84.000 visitas e 295.000 páginas vistas (fonte: sitemeter). Visitantes de todos os pontos do país e vários cantos do mundo revelam o sucesso destas 52 semanas.

Deixo hoje o mesmo vídeo que foi utilizado na primeira publicação deste blog:




"24 horas na vida de uma pessoa". Neste pequeno vídeo (retirado do Youtube) percorrem-se os vários núcleos geradores e os vários Domínios de Referência (desde o contexto macro estrutural (DR4) ao profissional (DR2), passando pelo privado (DR1) e pelo institucional (Dr3)).



Vídeo: 24 Horas na Minha Vida
Também poderá ser um recurso para Cursos EFA, pois o Unidade de Competência 6 "Modelos de Urbanismo e Mobilidade" encontra-se em destaque.

A todos os visitante ficam os votos de muito sucesso, tal como o que proporcionam a este blogue e a promessa de que continuará a ser actualizado, com novos conteúdos e recursos.
Obrigado pela sua Visita!

domingo, 22 de março de 2009

22 de Março - Dia da Água


A água disponível para consumo humano representa menos de 1% dos recursos hídricos do planeta estando localizada em rios, lagos e na atmosfera. Mais de 1,2 milhões de pessoas não tem acesso a água potável.
Por dia gastam-se muitos litros de água: 10 litros numa descarga de autoclismo, 80 litros num banho rápido, 100 litros numa lavagem de roupa na máquina e 50 litros numa lavagem de louça na máquina. O esforço para poupar água é uma obrigação.



Sociedade: Actuo face à multiplicidade de instituições com saberes e poderes diferenciados na gestão dos recursos naturais nas sociedades contemporâneas.
Tecnologia: Actuo nos debates técnicos sobre o ambiente e em particular sobre os processos de gestão de recursos naturais, energéticos, etc., distinguindo as posições em confronto, os interesses envolvidos, e discutindo as possibilidades de consensos (política da água, etc.).
Ciência: Actuo face aos debates sobre ambiente, pondo em evidência o papel da fundamentação científica rigorosa, reconhecendo a sua validade relativa.