quinta-feira, 29 de outubro de 2009

40º Aniversário do E-mail

A primeira mensagem de correio electrónico entre dois computadores (e-mail em rede) situados em locais distantes foi enviada a 29 de Outubro de 1969, quase dois meses depois do primeiro nó que deu origem à Internet.

O texto dessa primeira mensagem continha apenas duas letras e um ponto - "LO.". O investigador da Universidade da Califórnia em Los Angeles (UCLA) Leonard Kleinrock queria escrever "LOGIN", mas o sistema foi abaixo a meio da transmissão.

A mensagem seguiu do computador do laboratório de Kleinrock na UCLA para o de Douglas Engelbart no Stanford Research Institute, utilizando como suporte a recém-criada rede da ARPA (Advanced Research Projects Agency), agência financiada pelo governo norte-americano.

O primeiro nó de ligação entre dois computadores da Arpanet tinha sido estabelecido pouco tempo antes, em 02 de Setembro de 1969, pelo que a história da Internet e do e-mail em rede se confundem.

No início da década de 1960, surgiram alguns sistemas de troca de mensagens entre terminais de um mesmo computador, em tempo diferido (1961) e em tempo real (1965), mas o primeiro e-mail em rede foi transmitido apenas em 1969.

Dois anos depois, em 1971, Ray Tomlinson inventou os primeiros programas para envio de e-mails em rede através da Arpanet e criou a arroba ("at", em Inglês - @) para separar o login do utilizador do domínio do servidor.

Em 1976, a rainha de Inglaterra, Isabel II, enviou o seu primeiro e-mail, e em 1978 surgiu o primeiro spam, entendido como mensagem de correio electrónico enviada para múltiplos destinatários sem consentimento destes.

Quarenta anos depois, 70 por cento dos e-mails enviados diariamente são "spam", uma "praga" que acompanha o crescimento dos vírus e do marketing na Internet, mas que tem sido combatida, com relativo sucesso, por diversos sistemas de filtragem entretanto desenvolvidos.
O "spam" não é, contudo, o único adversário do e-mail, que encontra cada vez mais concorrentes noutros sistemas de comunicação de texto, áudio e vídeo, de envio de ficheiros e de troca de mensagens instantâneas, através de ferramentas como o Messenger, Skype e Twitter, a que se juntará em breve o Google Wave.
"Pela sua formalidade, o e-mail é algo pouco apelativo para os utilizadores mais jovens. Os blogs e o Twitter ocupam um espaço menos informal", disse à agência Lusa Libório Silva, autor do livro sobre correio electrónico mais vendido em Portugal, "e-mail", editado em 2008.
Libório Silva afirmou que o e-mail continua a ser uma ferramenta em expansão em todo o Mundo, pela facilidade de utilização e pela capacidade de envio de ficheiros associados a mensagens.
Libório Silva destacou como principal ruptura na história do e-mail o surgimento dos serviços de webmail, que são actualmente líderes de mercado entre utilizadores individuais, mas não nas empresas, que continuam a preferir servidores internos.
Outro momento importante foi o surgimento do e-mail da Google (gmail), oferecendo um gigabyte de capacidade, quando os serviços de então ofereciam apenas quatro megabytes, "250 vezes menos".
Apesar de popular, o e-mail continua a ser utilizado pela esmagadora maioria das pessoas sem certificados digitais de segurança, pelo que cada mensagem pode ser interceptada por "um qualquer técnico de informática que tenha acesso a um dos 'routers' por onde passa".
"Mais de 99 por cento dos e-mails são como postais, sem terem envelope por fora", comparou Libório Silva, realçando que só um por cento são "cartas lacradas".
Outros dos pioneiros da Internet em Portugal, Vítor Magalhães, disse à Lusa que "o e-mail continua a ser a funcionalidade da Internet que mais se mantém e que tem tido um desenvolvimento normal", sendo os fóruns de discussão e o Twitter "alternativas e não concorrentes".
Para Vítor Magalhães, "a tentativa da Google de destruir o e-mail através do Google Wave" não deverá ter o sucesso que a empresa prevê, porque o novo serviço contém o mesmo mecanismo e funcionalidade básica do e-mail, de comunicação textual e de transferência de conteúdo multimédia, pelo que não há uma mudança de conceito.



--

quarta-feira, 28 de outubro de 2009

Uma verdade mais que inconveniente

Um recurso para o núcleo: Ambiente e Sustentabilidade (STC2)
Documentário "Uma Verdade mais que Inconveniente"

Um documentário feito pelo "Partido dos Animais" da Holanda. É a resposta ao "An Inconvenient Truth" de Al Gore, que trata de algumas das causas do aquecimento global, poluição e outros problemas globais, mas deixa a questão da pecuária de lado (por motivos políticos). A pecuária é a maior responsável por essa devastação. Acha isso loucura? Assista!




quinta-feira, 22 de outubro de 2009

ECDL - Carta Europeia de Condução em Informática

O que é a ECDL?
(Clique na imagem para mais informações)

A ECDL é uma certificação internacional de competências nas TIC, para utilizadores, orientada para o mercado de trabalho, que atesta que o seu detentor possui as competências e conhecimentos que lhe permitem utilizar eficaz e produtivamente as principais aplicações informáticas para PC.

Como se obtém?

A ECDL obtém-se a partir da realização de 7 exames (correspondentes aos 7 módulos que a constituem), que incidem sobre as 7 principais áreas das TIC mais comummente utilizadas no mercado de trabalho, nomeadamente:

1-Introdução à Informática,
2-Utilização do Computador e Gestão de Ficheiros,
3-Processador de Texto,
4-Folhas de Cálculo,
5-Bases de Dados,
6-Apresentações
7-Internet e Correio Electrónico.


A quem se destina

A ECDL é uma Certificação independente da idade, das habilitações académicas, do estatuto social e da experiência ou formação em informática.

Destina-se as todas as pessoas que utilizem ou venham a utilizar o computador no seu dia-a-dia, seja a título profissional ou pessoal, seja um não especialistas ou um Licenciado em Sistemas de Informação e Comunicação.

Reconhecida por quem?

Com um padrão de competências definido e reconhecido internacionalmente, a Certificação ECDL assegura aos seus detentores a mobilidade do reconhecimento das suas competências em toda a Europa e nos cerca de 150 países dos 5 continentes onde a ECDL se encontra implementada.

Identificada a nível nacional como Carta Europeia de Condução em Informática a ECDL - European Computer Driving Licence assume-se como a Carta de Condução para as Auto-estradas da Informação e Conhecimento, tendo como principais objectivos:
  • Ultrapassar a designação vaga e comum utilizada nos curriculum vitae "Conhecimentos de Informática na Óptica do Utilizador" e garantir um padrão objectivo de competências;

  • Promover uma melhor utilização dos equipamentos informáticos e consequentemente a produtividade dos colaboradores das Empresas e Entidades públicas e privadas, assim como a rentabilização dos investimentos em TIC;

  • Validar competências e conhecimentos no domínio das TIC, através de um Certificado reconhecido em toda a Europa e Internacionalmente em cerca de 150 países.


Rede de Centros:

Clique Aqui


No Distrito de Castelo Branco

Castelo Branco

FDTI – CDTI de Castelo Branco
IPJ - Rua Dr. Francisco José Palmeiro
6000-230 Castelo Branco
Tel: 272 323703/348000
Fax: 272 348007/09
Email:
jaime.barata@fdti.pt
Contacto: Dr. Jaime Manuel Henriques Barata


Covilhã

CILAN
Rua Dr. Júlio Maria da Costa, nº 25
6200-130 Covilhâ
Tel: 275 320 300
Fax: 275 320309
Email:
cilan@mail.telepac.pt
Web:
http://www.cilan.pt/
Contacto: Engª Maria João Garret



Fonte: http://www.ecdl.pt/index.php?option=com_content&task=view&id=22&Itemid=25

quinta-feira, 15 de outubro de 2009

O Elemento (Hereditariedade)

A hereditariedade corresponde ao conjunto de processos biológicos que asseguram que cada ser vivo receba e transmita informações genéticas, através da reprodução. As informações genéticas determinam as características de um indivíduo e até a espécie à qual pertence. As características como a cor do cabelo, a estatura, o temperamento e a susceptibilidade para doenças são algumas das informações herdadas aquando da concepção. (Wikilivros)



sábado, 10 de outubro de 2009

O Elemento (Material Genético)

O ácido desoxirribonucleico (ADN, em português: ácido desoxirribonucleico; ou DNA, em inglês: deoxyribonucleic acid), é um composto orgânico cujas moléculas contêm as instruções genéticas que coordenam o desenvolvimento e funcionamento de todos os seres vivos e alguns vírus. O seu principal papel é armazenar as informações necessárias para a construção das proteínas e ARNs. Os segmentos de ADN que são responsáveis por carregar a informação genética são denominados genes. O restante da seqüência de ADN tem importância estrutural ou está envolvido na regulação do uso da informação genética.
Fonte: Wikipédia


sábado, 3 de outubro de 2009

Estrutura ADN

O ADN, Ácido DesoxirriboNucleico, é uma molécula biológica universal presente em todas as células vivas. É no ADN que está contida toda a nossa informação genética, sob a forma de genes. O ADN é constituído por quatro tipos de nucleótidos , unidade básica do ADN (que por sua vez é constituído por uma pentose, um grupo fosfato e uma base azotada), que se associam de uma forma específica, formando uma cadeia dupla: adenina (A) com timina (T) e guanina (G) com citosina (C). Os nucleótidos são designados deste modo devido às bases azotadas que entram nas suas constituições. É possível ler a cadeia de ADN, obtendo-se uma sequência de letras, como por exemplo, ATGATTCTGTAGCCTGATCCC, a uma sequência completa de ADN dá-se o nome de genoma.
O ADN tem a forma de uma escada de corda enrolada helicoidalmente, ou seja, de uma hélice dupla em que os degraus são formados por pares de bases azotadas ligadas entre si, através de ligações de hidrogénio, com fundamento na complementaridade de bases. A estrutura, do ADN, foi proposta há 53 anos por James Watson e Francis Crick. A descoberta da estrutura do ADN abriu o caminho para se compreender como é que a informação genética é transmitida de progenitores para descendentes, ou de uma célula para outra, isto é, como funciona a hereditariedade.

http://www.notapositiva.com/trab_estudantes/trab_estudantes/biologia/biologia_trabalhos/adn.htm